View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8979_low_25 (Length: 233)
Name: NF8979_low_25
Description: NF8979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8979_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 24883911 - 24884120
Alignment:
| Q |
11 |
gacatcacaaaggaactgctaagaaactcagaagttatagcagtaaatcaaggcaaggatgacatactaaaaatcctctaatctctcataatatccaatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24883911 |
gacatcacaaaggaactgctaagaaactcagaagttatagcagtaaatcaaggcaaggatgacagactaaaaatcctctaatctctcataatatccaatg |
24884010 |
T |
 |
| Q |
111 |
cttttaatactgataaccttttggttttgcagacaaattaggaattcaagggaagaaggtgaaaagtaatgatgatttggaggtgatttcctttcccctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884011 |
cttttaatactgataaccttttggttttgcagacaaattaggaattcaagggaagaaggtgaaaagtaatgatgatttggaggtgatttcctttcccctt |
24884110 |
T |
 |
| Q |
211 |
tttgttttct |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
24884111 |
tttgttttct |
24884120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 34593429 - 34593372
Alignment:
| Q |
137 |
ttgcagacaaattaggaattcaagggaagaaggtgaaaagtaatgatgatttggaggt |
194 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||| |||||||||| | ||||||||||||| |
|
|
| T |
34593429 |
ttgcagacaaactaggagttcaaggaaagaaagtgaaaagtactaatgatttggaggt |
34593372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University