View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8979_low_32 (Length: 208)
Name: NF8979_low_32
Description: NF8979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8979_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 49984453 - 49984279
Alignment:
| Q |
18 |
acgttgtacctatattctctttacattttgtgtggttgataaaagagatacagaagagagaaaataaagtgaaaataagagattattaaatatttacgcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49984453 |
acgttgtacctatattctctttacattttgtttggttgataaaagaggtatagaagagagaaaataaagtgaaaataagagattattaaatatttacgcc |
49984354 |
T |
|
| Q |
118 |
aacttatttgcggtcgataattttgtatggacttaacaaacattaggtcaaccccattatgatgactcatgatgt |
192 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49984353 |
aacttatttgcggtagataactttgtataaacttaacaaacattaggtcaaccccattatgatgactcatgatgt |
49984279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University