View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8979_low_33 (Length: 203)
Name: NF8979_low_33
Description: NF8979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8979_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 5e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 83 - 156
Target Start/End: Complemental strand, 54478995 - 54478922
Alignment:
| Q |
83 |
tgttctgatgtgagtgtgagtgagcaatgtgaggaaatttaatgggaaagagaatgaaaaaagacttcgatctt |
156 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
54478995 |
tgttctgatgcgagtgtgagtgagcaatgtgaggaaatttaatgggaaagagaatgaaaacagactttgatctt |
54478922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 54479060 - 54479020
Alignment:
| Q |
18 |
atccatcgatgtgttgaaagaataagagggagtgagttaat |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54479060 |
atccatcgatgtgttgaaagaataagagggagtgagttaat |
54479020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 148 - 188
Target Start/End: Original strand, 39578915 - 39578955
Alignment:
| Q |
148 |
ttcgatcttgtaatttgtctttaatggcattgtcttccaca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578915 |
ttcgatcttgtaatttgtctttaatggcattgtcttccaca |
39578955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University