View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8980_high_28 (Length: 218)
Name: NF8980_high_28
Description: NF8980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8980_high_28 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 126 - 201
Target Start/End: Original strand, 5928333 - 5928408
Alignment:
| Q |
126 |
attgttctgatcatagttatttgcaatgccatgatttcttatgtttatggattgagacattgttgatggtttgagt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5928333 |
attgttctgatcatagttatttgcaatgccatgatttcttatgtttgtggattgagacattgttgatggtttgagt |
5928408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 46956907 - 46956952
Alignment:
| Q |
1 |
taagctccattttttggttcaattttaactgatattttagctctga |
46 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
46956907 |
taagctctattttttggttcaattttaactggtattttggctctga |
46956952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 171
Target Start/End: Complemental strand, 22714597 - 22714569
Alignment:
| Q |
143 |
tatttgcaatgccatgatttcttatgttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22714597 |
tatttgcaatgccatgatttcttatgttt |
22714569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 171
Target Start/End: Original strand, 22990628 - 22990656
Alignment:
| Q |
143 |
tatttgcaatgccatgatttcttatgttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22990628 |
tatttgcaatgccatgatttcttatgttt |
22990656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 171
Target Start/End: Complemental strand, 200470 - 200442
Alignment:
| Q |
143 |
tatttgcaatgccatgatttcttatgttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
200470 |
tatttgcaatgccatgatttcttatgttt |
200442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University