View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8980_low_35 (Length: 340)
Name: NF8980_low_35
Description: NF8980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8980_low_35 |
 |  |
|
| [»] scaffold0836 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0836 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: scaffold0836
Description:
Target: scaffold0836; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 1991 - 2218
Alignment:
| Q |
17 |
acatcaaggaggaaacctgcttctgccagtagtcacactagatgagagttaattcaaggagctatttaacccgtgggcagggtccctggtgatcaagctc |
116 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1991 |
acatcaaggagtaaaccaacttctgccggtagtcacactagatgagtgttaattcaaggagctatttaacccgtgggcagggtccctggtgatcaagctc |
2090 |
T |
 |
| Q |
117 |
ttggacaaaactgttggttatca-tgtattgagggaacggctagaaaagttgtgaaaactatcaagggggcttccatatcatggatatcgataacgactt |
215 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
2091 |
ttggacaaaactgttggttaacattgtattgagggaacggctaaaaaagttgtggaaactatcaagggggcttcgatatcatggatatcgataacagctt |
2190 |
T |
 |
| Q |
216 |
ctacaaggtaaagtgtgacctgattgct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2191 |
ctacaaggtaaagtgtgacctgattgct |
2218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University