View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8980_low_40 (Length: 331)
Name: NF8980_low_40
Description: NF8980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8980_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 42 - 312
Target Start/End: Complemental strand, 4793294 - 4793024
Alignment:
| Q |
42 |
tctctctaaaagaatgggaaagtgaaccaaatgaggcgttgcgttggattgatgaggaatggaatggagattttcattgaaggaggggagccttttcatc |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4793294 |
tctctctaaaagaatgggaaagtgaaccaaatgaggcgttgcgttggattgatgaggaatggaatggagattttcattgaaggaggggagccttttcatc |
4793195 |
T |
 |
| Q |
142 |
taaggagaaggataaatggatatcgatgcttgaaacttcaaatgctttcacggctaattccctatatgtagccttgagttgtaaattcctccccacttct |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4793194 |
taaggagaaggataaatggatatgaatgcttgaaacttcaaatgctttcacggctaattccctatatgtagccttgagttgtaaattcctccccacttct |
4793095 |
T |
 |
| Q |
242 |
cgtttaagtgtcgcagtgtttgatatcattggtagacttcctactcctggaaacttatctacaaagggggt |
312 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
4793094 |
cgtttaagtgtcgcagtgtgtgatatcattggtagacttcctactcgtggaaacttatctataaagggggt |
4793024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 49
Target Start/End: Complemental strand, 4793355 - 4793323
Alignment:
| Q |
17 |
atgatatttagttgggggagaatcctctctcta |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4793355 |
atgatatttagttgggggagaatcctctctcta |
4793323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University