View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8980_low_48 (Length: 295)

Name: NF8980_low_48
Description: NF8980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8980_low_48
NF8980_low_48
[»] chr4 (2 HSPs)
chr4 (158-245)||(13083042-13083128)
chr4 (246-289)||(13083524-13083566)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 158 - 245
Target Start/End: Original strand, 13083042 - 13083128
Alignment:
158 aatcaaagatattatattaaaaacaaaagtttttcttgcaacattaccaataactaacatttgacataaattgtatcaaatttcataa 245  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13083042 aatcaaagatattatattaaaa-caaaagtttttcttgcaacattaccaataactaacatttgacataaattgtatcaaatttcataa 13083128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 246 - 289
Target Start/End: Original strand, 13083524 - 13083566
Alignment:
246 catgtgattagaaataaattaataatatttttgtattgatgggt 289  Q
    ||||||||||||| ||||||||||||||||||||||||||||||    
13083524 catgtgattagaa-taaattaataatatttttgtattgatgggt 13083566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University