View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8980_low_53 (Length: 273)
Name: NF8980_low_53
Description: NF8980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8980_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 11 - 258
Target Start/End: Complemental strand, 31870908 - 31870661
Alignment:
| Q |
11 |
cacagatcgccgcagaagatatcctcatcaaaatccccggcgccattcttcaccttattgatcaacaatacagcttcgaacttgctatcggtgatctcac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31870908 |
cacagatcgccgcagaagatatcctcatcaaaatccccggcgccattcttcaccttattgatcaacaatacagcttcgaacttgctatcagtgatctcac |
31870809 |
T |
|
| Q |
111 |
catcattcgtctccggcaggggaataacaccgtagctgtttacgctcgtgtcggcaatgagattcaatggccgcttgctaaggatgaagctgctgtgaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870808 |
catcattcgtctccggcaggggaataacaccgtagctgtttacgctcgtgtcggcaatgagattcaatggccgcttgctaaggatgaagctgctgtgaag |
31870709 |
T |
|
| Q |
211 |
gttgatgagtcgcattactttttctgctttcgtgtaccgaaggagaag |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870708 |
gttgatgagtcgcattactttttctgctttcgtgtaccgaaggagaag |
31870661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 37 - 125
Target Start/End: Original strand, 8850963 - 8851051
Alignment:
| Q |
37 |
atcaaaatccccggcgccattcttcaccttattgatcaacaatacagcttcgaacttgctatcggtgatctcaccatcattcgtctccg |
125 |
Q |
| |
|
|||||||||||||| |||||||| |||| || ||||||||||||||| | ||||||||| |||||| ||||| || | |||||||| |
|
|
| T |
8850963 |
atcaaaatccccggagccattctcaacctcatcgatcaacaatacagcgttgaacttgcttccggtgacttcaccgtcgtccgtctccg |
8851051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University