View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8980_low_69 (Length: 218)
Name: NF8980_low_69
Description: NF8980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8980_low_69 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 43062855 - 43063040
Alignment:
| Q |
17 |
aatggtttgtaccttccccagaaataatagaggaatcgcaccaaaagatatgtcgttgatattagtggacataagtcacattaatgcaacttgctacaat |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43062855 |
aatggtttgtaccttccccaaaaataatagaggaatcgcaccaaaagatatgttgttgatattagtggacattagtcacattaatgcaacttgctacaat |
43062954 |
T |
 |
| Q |
117 |
aatgtagttgagttgacaaaacatgcaaacggtctttatgatacttctttccaatcagagataatccaccacttaaccaaaatatc |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062955 |
aatgtagttgtgttgacaaaacatgcaaacggtctttatgatacttctttccaatcagagataatccaccacttaaccaaaatatc |
43063040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University