View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8980_low_70 (Length: 204)
Name: NF8980_low_70
Description: NF8980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8980_low_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 189
Target Start/End: Original strand, 1599062 - 1599240
Alignment:
| Q |
12 |
ttggtgttaatatgactatgtgtcaaaagctgtcatcagtgtc---atgcttaaaatccgaaactaggactgtttatggttcatttcatgaggaaaatca |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1599062 |
ttggtgttaatatgactatgtgtcaa--gctgtcatcagtgtcgtcatgcttaaaatccgaaactaggactgtttatggttcgtttcatgaggaaaatca |
1599159 |
T |
|
| Q |
109 |
aattcaaatgttgcaacagttttataaaactgaactgaaccgttaaccgtttgctctgaaccgaattgatatgaaggttga |
189 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1599160 |
aattgaaatgttgcaacagttttataaaactgaactgaaccgttaaccgtttgctctgaaccgaattgatatgaaggttga |
1599240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 12 - 151
Target Start/End: Complemental strand, 41222600 - 41222463
Alignment:
| Q |
12 |
ttggtgttaatatgactatgtgtcaaaagctgtcatcagtgtcatgcttaaaatccgaaactaggactgtttatggttcatttcatgaggaaaatcaaat |
111 |
Q |
| |
|
|||||||||||||||| |||| ||| || || ||||||||| ||||||| ||| |||||||||| ||| ||||||| ||||| || ||||||||||| |
|
|
| T |
41222600 |
ttggtgttaatatgaccatgtttcat--gccgttatcagtgtcgtgcttaatatctaaaactaggaccgttcatggttcgtttcaagaagaaaatcaaat |
41222503 |
T |
|
| Q |
112 |
tcaaatgttgcaacagttttataaaactgaactgaaccgt |
151 |
Q |
| |
|
| || ||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
41222502 |
tgaactgtaacaacagtttcataaaactgaaccgaaccgt |
41222463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University