View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_high_102 (Length: 281)
Name: NF8981_high_102
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_high_102 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 43726048 - 43726326
Alignment:
| Q |
1 |
tggaacgtttaaaggctttt-tacagtttgacacatgttataatttgtcgtctaataatactgtggagttgcctatagtggagtttgaagtaaatgatgg |
99 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
43726048 |
tggaacgtttaaaggcttttttacagtttgacacatgttataatttgtcgtctaataatactgtggagttgccgatattggagtttgaagtaaatgatgg |
43726147 |
T |
 |
| Q |
100 |
gaaatcgtggttgttgccgaaggagagttatttgtatgcagtggataagaatggaacattttgctttgcttttgcaccgtcaaaaggatcgttttcaatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43726148 |
gaaatcgtggttgttgccgaaggagagttatttgtatgcagtggataagaatggaacattttgctttgcgtttgcaccgtcaaaaggatcgttttcaatt |
43726247 |
T |
 |
| Q |
200 |
ttagggactttacagcaatacgggacacgtgtcacctttgatcttgttaactctttcgtttatttacacactctctgct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43726248 |
ttagggactttacagcaatacgggacacgtgtcacctttgatcttgttaactctttcgtttatttacacaccctctgct |
43726326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University