View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_high_107 (Length: 262)
Name: NF8981_high_107
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_high_107 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 17 - 252
Target Start/End: Original strand, 28090986 - 28091221
Alignment:
| Q |
17 |
gatacatgtggaatgagttgaatggcatgctgtcttggttgtgttaccttttttgttagattgttgaataagagttgattgccttcgatcctgaagcatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28090986 |
gatacatgtggaatgagttgaatggcatgctgtcttggttgtgttaccttttttgttagattgttgaataagagttgattgccttcgatcctgaagcatt |
28091085 |
T |
 |
| Q |
117 |
gcaccaccaacagaaaattttctggtatttggaactcctgttgaacatctaggagcctttatcccacttttacttgggctgggttttgatccaaaaagtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28091086 |
gcaccaccaacagaaaattttctggtatttggaactcctgttgaacatctaggagcctttatcccacttttacttgggctgggttttgatccaaaaagtg |
28091185 |
T |
 |
| Q |
217 |
tttcatgctctgccaacagttgtccctttagtctct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28091186 |
tttcatgctctgccaacagttgtccctttagtctct |
28091221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University