View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_high_129 (Length: 231)
Name: NF8981_high_129
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_high_129 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 34 - 213
Target Start/End: Original strand, 36429153 - 36429332
Alignment:
| Q |
34 |
agcaaaaaccgacccgtccctgccgccgccaccgatacaaccaccaacaattcaaaagtaaggcttct-ccttaggccctcccggttccatcggaatcct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
36429153 |
agcaaaaaccgacccgtccctgccgccgccaccgatacaaccaccaacaattcaaaagtaaggcttctcccttagg-cctcccggttccatcggaatcct |
36429251 |
T |
|
| Q |
133 |
cgccgtcttgccggaagatgaagaatcttttgatgccggaaacgtccatgaagctccggtctcggtttctctctccgcttc |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36429252 |
cgccgtcttgtcggaagatgaagaatcttttgatgccggaaacgtccatgaagctccggtctcggtttctctctccgcttc |
36429332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 36431946 - 36432004
Alignment:
| Q |
102 |
ccttaggccctcccggttccatcggaatcctcgccgtcttgccggaagatgaagaatct |
160 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
36431946 |
ccttaggccctcccgattccttcggagtcctcgccgtcttgccggaaaacgaagaatct |
36432004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University