View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_high_59 (Length: 410)
Name: NF8981_high_59
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_high_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 23 - 395
Target Start/End: Original strand, 23628675 - 23629047
Alignment:
| Q |
23 |
cagaaatttgccaccaagggtaaactggggaattcggtaaatctgcgaacacaactacgaaatttggattattcaggttgtcattttgaggtaagtcacg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23628675 |
cagaaatttgccaccaagggtaaactggggaattcggtaaatccgcgaacgaaactacggaatttggattattcaggttgtcattttgaggtaagtcacg |
23628774 |
T |
 |
| Q |
123 |
ccataagttgaatgagacagagaatgcaaaggctccagaaggcgaaaagactaaacgcggcacgtggagatcacgtgcaaggagatgagtccaaccaagg |
222 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23628775 |
ccataaggtgaatgagacagagaatgcaaaggctccagaaggcgaaaagactaaacgcggcacgtggagatcacgtgcaaggagatgagtccaaccaagg |
23628874 |
T |
 |
| Q |
223 |
aaaaagtcagagattatagctgaaggaggtaaagggtgggtttgtgcaaagttaaggatgatttggtagtggtgttgacgcatgaaagagactaaagcaa |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23628875 |
aaaaagtcagagattatagctgaaggaggtaaagggtgggtttgtgcaaagttaaggatgatttggtagtggtgttgacgcatgaaagagactaaagcaa |
23628974 |
T |
 |
| Q |
323 |
cgagtctgttttgatttgggttagggaattgagatgcagggagaatgagagtatgaagaagaggggaatagtt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
23628975 |
cgagtctgttttgatttgggttagggaattgagatgcagggagaatgagagtttggagaagaggggaatagtt |
23629047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University