View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_high_61 (Length: 401)
Name: NF8981_high_61
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_high_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 1 - 394
Target Start/End: Complemental strand, 40472849 - 40472455
Alignment:
| Q |
1 |
ctcaggtgaacattcagtgcaacataccataatgcagtgttttaaaaaccga-ctggaagttccaaccgagtgaaccttgaacggaccactactatggtg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40472849 |
ctcaggtgaacattcagtgcaacataccataatgcagtgttttaaaaactgaactggaagttccaaccgagtgaaccttgaacggaccactactatggtg |
40472750 |
T |
 |
| Q |
100 |
tggttattttggcggttcgattttggtttcgtctcgattcgagtggtttaagacggttgaatcatgacctagaggtcatgccggattgatgtccgttttg |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40472749 |
tggttattttggcagttcgattttggtttcgtctcgattcgagcggtttaagacggttgaatcatgacctagaggtcatgccggattgatgtccgttttg |
40472650 |
T |
 |
| Q |
200 |
gtttttaaaacattgccatactgttttgaaatgcttcttggtttctaatgtatgttgtgtttttatcaattacaggctaatatttctggaggtgcactta |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
40472649 |
gtttttaaaacattgccatactgttttgaaatgcttcttggtttctaatgtatgttgtgtttttaccaattacaggttaatatttctggaggtgcactta |
40472550 |
T |
 |
| Q |
300 |
gcagttcttctgacatggatcccaaacctgataccaatcaatctctcatttacaaaccaatggcaaaatttgtgtcacaaacaaccgtctctctg |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40472549 |
gcagttcttctgacatggatcccaaacctgataccaatcaatctctcatttacaaaccaatggcaaaatttgtgtcacaaacaaccgtctctctg |
40472455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 15190546 - 15190591
Alignment:
| Q |
170 |
agaggtcatgccggattgatgtccgttttggtttttaaaacattgc |
215 |
Q |
| |
|
||||||| |||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
15190546 |
agaggtcttgccggtttgatgtctgctttggtttttaaaacattgc |
15190591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University