View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_164 (Length: 368)
Name: NF8981_low_164
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_164 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 46 - 349
Target Start/End: Original strand, 15288608 - 15288911
Alignment:
| Q |
46 |
gaaactctgaaccattttcgccaagcaaacagagcttggttccaactcagcaactccaccagcaccatctttagtggtattgttcttcggaaaaggtttc |
145 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288608 |
gaaactttgaaccattttcgccaagcaaacagagcttggttccaactcagcaactccaccagcaccatctttagtggtattgttcttcggaaaaggtttc |
15288707 |
T |
 |
| Q |
146 |
tcgaaagcgaaaaacctcttcaacctccatttcgaaactggttcatttcgaaccagttccgtagtggctttctctgaatctatgtcaatcggttggatct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288708 |
tcgaaagcgaaaaacctcttcaacctccacttcgaaactggttcatttcgaaccagttccgtagtggctttctctgaatctatgtcaatcggttggatct |
15288807 |
T |
 |
| Q |
246 |
tcaacggagccattaatcttcttctcaaacaacaaaaatgctagctttaaattgaagagtcaaaattacaagctagtcaacaaagtcaataactcatagt |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288808 |
tcaacggagccattaatcttcttctcaaacaagaaaaatgctagctttaaattgaagagtcaaaattacaagctagtcaacaaagtcaataactcatagt |
15288907 |
T |
 |
| Q |
346 |
caca |
349 |
Q |
| |
|
|||| |
|
|
| T |
15288908 |
caca |
15288911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University