View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_178 (Length: 347)
Name: NF8981_low_178
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_178 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 20 - 331
Target Start/End: Original strand, 747758 - 748069
Alignment:
| Q |
20 |
gggttcgcgactgtatacgagagacctgaggaggcgaagagtgctttgctgatatgacgatgtgtcatattgaatgagatatgaacaagttcttgctcag |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
747758 |
gggttcgcgactgtatatgagagacctgaggaggcgaagagtgctttgctgatgtgacggtgtgtcatattgaatgagatatgaactagttcttgctcag |
747857 |
T |
|
| Q |
120 |
aagctgaggttgagccagggaaatctaagagagagtttatacaaagtgaagggtatctagttttgctgcaggttctggagattgcttgagttggtttgga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
747858 |
aagctgaggttgagccagggaaatctaagagagagtttatacaaagtgaagggtatctagttttgctgcaggttcgggagattgcttgagttggtttgga |
747957 |
T |
|
| Q |
220 |
atggagaaggtttgaattgttggatgaagcacgagaccggaccacggtgatcagtgcagccgagatggcggaagcaatgatcaagacggcggcgaggatg |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
747958 |
atggagaaggtttgaattgttggatgaagcacgagaccggaccacggtgatcagtgcagccgagatggcggaagcgatgatcaagacggcggcgaggatg |
748057 |
T |
|
| Q |
320 |
gacagtatgatg |
331 |
Q |
| |
|
||||| |||||| |
|
|
| T |
748058 |
gacagcatgatg |
748069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University