View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_192 (Length: 327)
Name: NF8981_low_192
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_192 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 17 - 178
Target Start/End: Complemental strand, 1396385 - 1396224
Alignment:
| Q |
17 |
agcaagctgatattgccatcaccacttgggtcgtgcatcttcttgtcgaaacaaacagtgcacgaaatcacctcatcatctttcggatggctaacaaaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1396385 |
agcaagctgatattgccatcaccacttgggtcgtgcatcttcttgtcgaaacaaacattgcacgaaatcacctcatcatctttcggatggcccacaaaaa |
1396286 |
T |
|
| Q |
117 |
tattgtctagaaactgagactgtaaactcatttcaactaattaggggcacgaaccattactg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
1396285 |
tattgtctagaaactgagactgtaaactcatctcaactaattagggtcaggaaccattactg |
1396224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 224 - 326
Target Start/End: Complemental strand, 1396209 - 1396107
Alignment:
| Q |
224 |
gaaagtgcattttccttcacaataaacttacttgggacacttcctatatcaataaattaccactaattcctatcgagcgacattcagaattagttgtcga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1396209 |
gaaagtgcattttccttcacaataaacttacttgggacacttcctatatcaagaaattaccactaattcctatcgagccacattcagaattagttgtcga |
1396110 |
T |
|
| Q |
324 |
aca |
326 |
Q |
| |
|
||| |
|
|
| T |
1396109 |
aca |
1396107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University