View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_203 (Length: 308)
Name: NF8981_low_203
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_203 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 175 - 298
Target Start/End: Complemental strand, 17432350 - 17432227
Alignment:
| Q |
175 |
tttccttacactacatttatattctacctcattccctcccttttagttcctatcttaatcacttgccacaagtgcatgttgttacaactcacgtccctaa |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17432350 |
tttccttacactacatttatattctacctcattccctcccttttagttcctatcttaatcacttgccacaagtgcatgttgttacaactcacgtccctaa |
17432251 |
T |
|
| Q |
275 |
aaaacctctgtccttgcatctctg |
298 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
17432250 |
aaaacctctgtccttgcatttctg |
17432227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 17432425 - 17432375
Alignment:
| Q |
124 |
agagagacaaaaatgcaataacatttcaagaaattgcaacgttgcttgcca |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17432425 |
agagagacaaaaatgcaataacatttcaagaaattgcaaccttgcttgcca |
17432375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University