View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_212 (Length: 303)
Name: NF8981_low_212
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_212 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 188 - 282
Target Start/End: Complemental strand, 8908958 - 8908864
Alignment:
| Q |
188 |
tataatgcaacgtttttgtttgatggatgaattttaggcttgcatattctcatgctattttagtaaataaaatattttatcctccaactttggtg |
282 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8908958 |
tataatgcaacgtttttgtttgattgatgaattttaggcttgcatattctcatgctattttagtatataaaatattttatcctccaactttggtg |
8908864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 15 - 107
Target Start/End: Complemental strand, 8909086 - 8908994
Alignment:
| Q |
15 |
tggtggtcggttgaaataacatgttgaaacttctcaactccaaacttgcttctaatcgttggtttattttctattgctacttatatcagtggg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8909086 |
tggtggtcggttgaaataacatgttgaaacttctcaactccaaccttgcttctaatcgttggtttattttctattgctactgatatcagtggg |
8908994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University