View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_234 (Length: 282)
Name: NF8981_low_234
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_234 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 266
Target Start/End: Original strand, 42836532 - 42836773
Alignment:
| Q |
19 |
aaattttacctcgtccgtagaatttttcacagatttcgttccatctcgatggatgccga----gtttcctagagtcattcaggtaccaaaaattggaccc |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42836532 |
aaatttaacctcgtccgtagaatttttcacagatttcgttccatctcgatggataccgatcgagtttcctagtgtcattcaggtaccaaaaattggaccc |
42836631 |
T |
|
| Q |
115 |
cgccatgtcctaccatctcgcaactatcagaatttgaaagctcacgtgatggtgacatgctcttgagatattcttttttgggaaatgctttgtatcgcga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42836632 |
cgccatgtcctaccatctcgcaactatcagaatttgaaagctcacgtgatggtgacatgctcttgagatattcttttttgggaaatgctttgt------- |
42836724 |
T |
|
| Q |
215 |
gacaatgcatcccgactagatcacgaatatccatggatgcggatagtgtgat |
266 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42836725 |
---aatgtatcccgactagatcacgaatatccatggatgcggatagtgtgat |
42836773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 194 - 243
Target Start/End: Complemental strand, 36512962 - 36512913
Alignment:
| Q |
194 |
gggaaatgctttgtatcgcgagacaatgcatcccgactagatcacgaata |
243 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||| ||||||||||||||||| |
|
|
| T |
36512962 |
gggaaatgctttgtatcacgagaaaattcatctcgactagatcacgaata |
36512913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 29826563 - 29826515
Alignment:
| Q |
193 |
tgggaaatgctttgtatcgcgagacaatgcatcccgactagatcacgaa |
241 |
Q |
| |
|
|||||||||||||||||| ||||| | | ||||||||||||||| |||| |
|
|
| T |
29826563 |
tgggaaatgctttgtatcccgagaaagttcatcccgactagatcgcgaa |
29826515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University