View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_273 (Length: 242)
Name: NF8981_low_273
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_273 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 35710250 - 35710074
Alignment:
| Q |
1 |
tgcagcccaaactaacttggttgagacacggtaagcaaagtaggagttaagcactcaactgacagcgttgattcccttgatgctattggagctgagattg |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35710250 |
tgcagcacaaactaacttggttgagacacagtaagcaaagtaggagttaagcgctcaactgacagcgttgattcccttgatgctattggagctgagattg |
35710151 |
T |
 |
| Q |
101 |
gcgagacatctataaccaaaccagtaaagatggttagtgtgaaggttgagccgaatgaaggaaaatgatgttccatc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35710150 |
gcgagacatctataaccaaaccagtaaaaatggtttgtgtgaagggtgagccgaatgaaggaaaatgatgttccatc |
35710074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University