View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_274 (Length: 240)
Name: NF8981_low_274
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_274 |
 | |
|
| [»] scaffold1452 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 43947615 - 43947845
Alignment:
| Q |
1 |
acttcaaattgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43947615 |
acttcaaattgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaa |
43947714 |
T |
|
| Q |
101 |
aagtttgtttatttaagtgggattgtatgatatggttggtagatatgggatactgcaggacaagagagattccaaagtcttggagttgcgttttatagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43947715 |
aagtttgtttatttaagtgggattgtatgatatggttggtagatatgggatactgctggacaagagagattccaaagtcttggagttgcgttttatagag |
43947814 |
T |
|
| Q |
201 |
gggcggattgctgtgttcttgcgtatgatgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43947815 |
gggcggattgctgtgttcttgcgtatgatgt |
43947845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1452 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold1452
Description:
Target: scaffold1452; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 139 - 219
Target Start/End: Complemental strand, 579 - 499
Alignment:
| Q |
139 |
gtagatatgggatactgcaggacaagagagattccaaagtcttggagttgcgttttatagaggggcggattgctgtgttct |
219 |
Q |
| |
|
|||||||||||| |||||||| || |||||||| ||||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
579 |
gtagatatgggacactgcagggcaggagagatttcaaagtcttggtgttgcattttatagaggggccgattgctgtgttct |
499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 38408695 - 38408771
Alignment:
| Q |
141 |
agatatgggatactgcaggacaagagagattccaaagtcttggagttgcgttttatagaggggcggattgctgtgtt |
217 |
Q |
| |
|
|||| ||||||||||||||||| || || ||||| |||||||||| ||| ||||| |||||||| ||||| |||||| |
|
|
| T |
38408695 |
agatttgggatactgcaggacaggaaaggttccatagtcttggagctgcattttacagaggggcagattgttgtgtt |
38408771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 221
Target Start/End: Complemental strand, 26274250 - 26274170
Alignment:
| Q |
141 |
agatatgggatactgcaggacaagagagattccaaagtcttggagttgcgttttatagaggggcggattgctgtgttcttg |
221 |
Q |
| |
|
|||| |||||||| || || || |||||||||||||| || |||||||| || ||| | ||||| |||||||||||||||| |
|
|
| T |
26274250 |
agatttgggatacagctggccaggagagattccaaagcctaggagttgctttctatcgtggggctgattgctgtgttcttg |
26274170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University