View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_280 (Length: 238)
Name: NF8981_low_280
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_280 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 69 - 194
Target Start/End: Original strand, 42307645 - 42307770
Alignment:
| Q |
69 |
ccgcgttttttcaacaaaaggaataatagtattacggcaattcgaatgattattgccaacactgcccaacacatggaaattgcaaaacaaaagtgagaat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42307645 |
ccgcgttttttcaacaaaaggaataatagtattacggcaattcgaatgattattgccaacactgcccaacacatggaaattgcaaaacaaaagtgagaat |
42307744 |
T |
 |
| Q |
169 |
catgaagacctaaaaatagaagaagc |
194 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42307745 |
catgaagacctaaaaatagaagaagc |
42307770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University