View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8981_low_280 (Length: 238)

Name: NF8981_low_280
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8981_low_280
NF8981_low_280
[»] chr7 (1 HSPs)
chr7 (69-194)||(42307645-42307770)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 69 - 194
Target Start/End: Original strand, 42307645 - 42307770
Alignment:
69 ccgcgttttttcaacaaaaggaataatagtattacggcaattcgaatgattattgccaacactgcccaacacatggaaattgcaaaacaaaagtgagaat 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42307645 ccgcgttttttcaacaaaaggaataatagtattacggcaattcgaatgattattgccaacactgcccaacacatggaaattgcaaaacaaaagtgagaat 42307744  T
169 catgaagacctaaaaatagaagaagc 194  Q
    ||||||||||||||||||||||||||    
42307745 catgaagacctaaaaatagaagaagc 42307770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University