View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_285 (Length: 236)
Name: NF8981_low_285
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_285 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 24964865 - 24964661
Alignment:
| Q |
15 |
atttttcccttgtttttggttcaaaaagagacaacattggagaaggaaagaatcaaaggttacgtccaccaaacgcatagatcagtggaagagattaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24964865 |
atttttcccttgtttttggttcaaaaagagacaaaattggagaaggaaagaatcaaaggttacgtccaccaaacgcatagatcagtggaagagattaaat |
24964766 |
T |
 |
| Q |
115 |
atgaagctgaatttgaagtaccacaaagttttggagatattggtgcagttcttgtggaaaatgagcatagaagggaaatgtttataaagaacattgttct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24964765 |
atgaagctgaatttgaagtaccacaaagttttggagatattggtgcagttcttgtggaaaatgagcatagaagggaaatgtttataaagaacattgttct |
24964666 |
T |
 |
| Q |
215 |
tgatg |
219 |
Q |
| |
|
||||| |
|
|
| T |
24964665 |
tgatg |
24964661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University