View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8981_low_291 (Length: 232)

Name: NF8981_low_291
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8981_low_291
NF8981_low_291
[»] chr1 (1 HSPs)
chr1 (1-218)||(48885936-48886153)


Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 48886153 - 48885936
Alignment:
1 gggattatcaagattgcgaatgatgacggatcgtgcagtgcaatagagaatgttgttggttttgggatcgccggagatgagaatgccgcggccgcgttcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48886153 gggattatcaagattgcgaatgatgacggatcgtgcagtgcaatagagaatgttgttggttttgggatcgccggagatgagaatgccgcggccgcgttcg 48886054  T
101 gtggaaggtgcgcaagcgtaggtttcagagagagttgccattgatggaattgagggtattgtgcgtgtagtgtgaagttgttatgctattgctatggttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48886053 gtggaaggtgcgcaagcgtaggtttcagagagagttgccattgttggaattgagggtattgtgcgtgtagtgtgaagttgttatgctattgctatggttt 48885954  T
201 ctttcttcatattgtttt 218  Q
    ||||||||||||||||||    
48885953 ctttcttcatattgtttt 48885936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University