View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_299 (Length: 224)
Name: NF8981_low_299
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_299 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 5 - 120
Target Start/End: Complemental strand, 36429140 - 36429025
Alignment:
| Q |
5 |
tgtttattgttgtgagaaagtgaaaggtggatttggcggcgtaaaaatgatgataggtgaaaaaagttttaatgagaaagatgagtgtagaaaatcattg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36429140 |
tgtttattgttgtgagaaagtgaaaggtggatttggcggcgtaaaaatgatgataggtgaataaagttttaatgagaaagatgagtgtagaaaatcattg |
36429041 |
T |
 |
| Q |
105 |
ccattaattactcatc |
120 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36429040 |
ccattaattactcatc |
36429025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University