View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8981_low_306 (Length: 217)
Name: NF8981_low_306
Description: NF8981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8981_low_306 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 43 - 200
Target Start/End: Original strand, 53556264 - 53556421
Alignment:
| Q |
43 |
agaagtttctaataatgttcattttaattccctgcttaattaatcttgttcagcttaatctttcccatcgtatcatgtgaatcttccattattttctagg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53556264 |
agaagtttctaataatgttcattttaattccctgcttaattaatcttgttcagcttaatctttcccatcgtatcatgtgaatcttctattattttctagg |
53556363 |
T |
 |
| Q |
143 |
taattatggagctctattttagagggtaagtttcaaatctctttgaacctttagacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
53556364 |
taattatggagctctattttagagggtaaatttcaaatctcttcgaacctttagacat |
53556421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University