View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8983_high_16 (Length: 238)
Name: NF8983_high_16
Description: NF8983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8983_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 8256042 - 8255877
Alignment:
| Q |
18 |
ttaagaacgaagataagaacataattgatataacaaagataagaatcacaagtaggcatcaacaatttttgaagagaacacctctgttgtgtaccaattc |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8256042 |
ttaagaacgatgataagaacataattgatataacaaagataagaatcacaagtaggcatcaacaatttttgaagagaacacctctgttgtgtaccaattc |
8255943 |
T |
 |
| Q |
118 |
aacctctaatgaatttctccgctagagcacaagtttctcatatgaagagtgattccaagatgacta |
183 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8255942 |
aacctctaatgaatttctccgctagaacacaagtttctcatatgaagagtgattccaagatgacta |
8255877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University