View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8983_high_18 (Length: 232)
Name: NF8983_high_18
Description: NF8983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8983_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 48065864 - 48066087
Alignment:
| Q |
1 |
agttagatggatatttccacttcttctatctaatttaagaccattcatgacgattgagcggtttgctttaaatcattgggaggtggtagaaacaagacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48065864 |
agttagatggatatttccacttcttctatctaatttaagaccatccatgacgattgagcggtttgctttaaatcattggcaggtggtagaaacaagacat |
48065963 |
T |
|
| Q |
101 |
taatgagtttacatttcagagtgtcaaatgatcaaaccttatatatcccccttcccaattgcatgatccataccaaaatgagattcacattattatacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065964 |
taatgagtttacatttcagagtgtcaaatgatcaaaccttatatatcccccttcccaattgcatgatccataccaaaatgagattcacattattatacaa |
48066063 |
T |
|
| Q |
201 |
ataataacactcttgtctctgctc |
224 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
48066064 |
ataataacactcttgtcactgctc |
48066087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University