View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8983_low_30 (Length: 275)

Name: NF8983_low_30
Description: NF8983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8983_low_30
NF8983_low_30
[»] chr2 (3 HSPs)
chr2 (16-112)||(5775025-5775121)
chr2 (169-260)||(5773998-5774089)
chr2 (144-172)||(5774965-5774993)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 16 - 112
Target Start/End: Complemental strand, 5775121 - 5775025
Alignment:
Q  16 agatgattggactagagagagtaagaaaaataagaattgacaattttctatccaacttcgaagagaccataattttgaattaagaataaggccaaga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  5775121 agatgattggactagagagagtaagaaaaataagaattgacaattttctatccaacttccaagagaccataattttgaattaagaataaggccaaga 5775025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 169 - 260
Target Start/End: Complemental strand, 5774089 - 5773998
Alignment:
Q  169 ttagtgtcgaactagtaattatccattggttttgacagaaagtaataacaaaggcacaacttttagattctcttggaactaacataaatagt 260  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5774089 ttagtgtcgaaccagtaattatccattggttttgacagaaagtaataacaaaggcacaacttttagattctcttggaactaacataaatagt 5773998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 172
Target Start/End: Complemental strand, 5774993 - 5774965
Alignment:
Q  144 cttttgatgaaagttaacagtatatttag 172  Q
    |||||||||||||||||||||||||||||    
T  5774993 cttttgatgaaagttaacagtatatttag 5774965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University