View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8983_low_31 (Length: 262)
Name: NF8983_low_31
Description: NF8983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8983_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 48065670 - 48065467
Alignment:
| Q |
1 |
cgaaacaagtacaattaggtaggtgttggaacatcaaatatattggacatttcgttttaatgcgtgtttcgttcaacagtcaaattaacaaaatcacgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48065670 |
cgaaacaagtacaattaggtaggtgttggaacatcaaatatattggacatttcgtt-----------------caacagtcaaattaacaaaatcacgga |
48065588 |
T |
 |
| Q |
101 |
gaatggcaaacgctacactatgcaggttcacaaaatcacgatggttcacgttgattttacaatctcaccaaacatatcaaacatgattttaaaaacatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065587 |
gaatggcaaacgctacactatgcaggttcacaaaatcatgatggttcacggtgattttacaatctcaccaaacatatcaaacatgattttaaaaacatta |
48065488 |
T |
 |
| Q |
201 |
ttaaattgttagatttaatta |
221 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
48065487 |
ttaagttgttagatttaatta |
48065467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University