View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8983_low_38 (Length: 240)
Name: NF8983_low_38
Description: NF8983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8983_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 115 - 226
Target Start/End: Complemental strand, 28444482 - 28444371
Alignment:
| Q |
115 |
gaaaattagaacctgataggtgtagtgccaacaacaagaacagaaccatgcgagcgacgataagaagaatcattacgaagtttaagacagtgtttcacaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||| |||||||||||||||| |
|
|
| T |
28444482 |
gaaaattagaacctgataggtgtagttccaacaacaagaacagaaccatgagagcgacgataagaagaattattgcgaagtttgagacagtgtttcacaa |
28444383 |
T |
 |
| Q |
215 |
atgggttagaag |
226 |
Q |
| |
|
||||||| |||| |
|
|
| T |
28444382 |
atgggtttgaag |
28444371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 28444560 - 28444499
Alignment:
| Q |
1 |
attacaatttcaaaatccattttccaattcataagattagactacaaccaaaaccaaggaaa |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
28444560 |
attacaatttcaaaatccattttccaattcacaagattagactacaaccaaaaccaaagaaa |
28444499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University