View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8983_low_39 (Length: 240)

Name: NF8983_low_39
Description: NF8983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8983_low_39
NF8983_low_39
[»] chr4 (1 HSPs)
chr4 (17-236)||(38867118-38867337)


Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 38867337 - 38867118
Alignment:
17 atgtataacgaccccatttggaaacttcagggtttgaagtaaaaaagagtttttgaggcattcctacccaaggagagaaaacaccgagtactatgatgag 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38867337 atgtataacgaccccatttggaaacttcagggtttgaagtaaaaatgagtttttgaggcattcctacccaaggagagaaaacaccgagtactatgatgag 38867238  T
117 ggataatagtgaaaggagaattgcggggctgaaaattgaaaggggttttttgggatttgttgaagaaggttgtgaagatggaaatggatttgaaaattgg 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38867237 ggataatagtgaaaggagaattgcggggctgaaaattgaaaggggttttttgggatttgttgaagaaggttgtgaagatggaaatggatttgaaaattgg 38867138  T
217 aatgggttgtggagtgatct 236  Q
    ||||||||||||||||||||    
38867137 aatgggttgtggagtgatct 38867118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University