View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8984_low_41 (Length: 303)
Name: NF8984_low_41
Description: NF8984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8984_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 15 - 285
Target Start/End: Complemental strand, 9485369 - 9485093
Alignment:
| Q |
15 |
cagagacgagttcggtcacgtgagtcaggaccgattttgattaaccaagggttgttgttcagggtttgttgatgatgatgat------ttgtggggggtg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
9485369 |
cagagacgagttcggtcacgtgagtcaggaccgattttgattaaccaagggttgttgtttagggtttgttgatgatgatgatgatgatttgtggggggtg |
9485270 |
T |
 |
| Q |
109 |
tgataaggaaaatggttcgtttggagagagggaaagtgatggatttggaatgatggagattgttggaatcggaaggagttgggaggtgagaaggtaaagt |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9485269 |
tgataaggaaaatggttcgtttggaaagagggaaagtgatggatttggaatgatggagattgttggaatcggaaggagttgggaggtgagaaggtaaagt |
9485170 |
T |
 |
| Q |
209 |
gagatggtggtgatggtttttgggaacggaagagcgccatgatgaacaaacggatcggaaacggagttggtagaatt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9485169 |
gagatggtggtgatggtttttgggaacggaagagcgccatgatgaacaaacggatcggaaacggagttggtagaatt |
9485093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 225 - 285
Target Start/End: Original strand, 23205864 - 23205924
Alignment:
| Q |
225 |
tttttgggaacggaagagcgccatgatgaacaaacggatcggaaacggagttggtagaatt |
285 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| || || ||||||||||| |||| |
|
|
| T |
23205864 |
tttttgggaatggaagagtgccatgatgaacaaacggaacgaaagcggagttggtataatt |
23205924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 15 - 65
Target Start/End: Original strand, 23205690 - 23205740
Alignment:
| Q |
15 |
cagagacgagttcggtcacgtgagtcaggaccgattttgattaaccaaggg |
65 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
23205690 |
cagagacgagttttatcacgtgagtctggtccgattttgattaaccaaggg |
23205740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University