View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8984_low_55 (Length: 275)
Name: NF8984_low_55
Description: NF8984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8984_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 41886954 - 41887215
Alignment:
| Q |
1 |
aacattgaagtctttatccatttccaatcctcacactagaaatctaacacatattacttcacattttattgacagcttggtaagtttgaaaggacttgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41886954 |
aacattgaagtctttatccatttccaatccttacactagaaatctaacacatattacttcacattttattgacagcttggtaagtttgaaaggacttgac |
41887053 |
T |
 |
| Q |
101 |
ttgtcttgatttgtggtttttgaatatctcggatgagttgctttcatcttttgcaatggaaggtcctcctgacgaggcttaccttctgaaattgcagagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41887054 |
ttgtcttgatttgtggtttttgaatatctcggatgagttgctttcatcttttgcaatggaaggtcctcctgacgaggcttaccttctgaaattgcagagg |
41887153 |
T |
 |
| Q |
201 |
caatagttacttcggaatattttgttgggccatcttcaaaatgctgagttgtagaattgtct |
262 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41887154 |
caatagttacttcggaatatttcgttgggccatcttcaaaatgctgagttgtagaattgtct |
41887215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 77 - 164
Target Start/End: Original strand, 41888933 - 41889019
Alignment:
| Q |
77 |
ttggtaagtttgaaaggacttgacttgtcttgatttgtggtttttgaatatctcggatgagttgctttcatcttttgcaatggaaggt |
164 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||||| | |||||||||||| |||||| ||||||| ||| |||||||| ||||| |
|
|
| T |
41888933 |
ttggtgagtttgaa-gtacttgacttgtcttgatttgttttctttgaatatctccgatgagatgctttcctctattgcaatgcaaggt |
41889019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 130
Target Start/End: Complemental strand, 10615326 - 10615252
Alignment:
| Q |
55 |
tacttcacattttattgacagcttggtaagtttgaaaggacttgacttgtcttgatttgtggtttttgaatatctc |
130 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
10615326 |
tacttcacattttattgactcattggtgagtttgaaggg-cttgacttgtcttgatttgcagtttatgaatatctc |
10615252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University