View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8984_low_68 (Length: 238)
Name: NF8984_low_68
Description: NF8984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8984_low_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 11608440 - 11608643
Alignment:
| Q |
19 |
atggggaccctacactgatgaggtttttgattgctcggtcaatggattcagataaagcagcaaagatgtttgtccaatggcagaaatggagggctactat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11608440 |
atggggaccctacactgatgaggtttttgattgctcgatcaatggattcagataaagcagcaaagatgtttgtccaatggcagaaatggagggctactat |
11608539 |
T |
|
| Q |
119 |
ggtgcctaatgatgggttcatttcagattctgaagttcctgatgaattggaaactagaaagatctttttgcagggtttgtctaaggataaatatcctgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11608540 |
ggtgcctaatgatgggttcatttcagattctgaagttcctgatgaattggaaactagaaagatctttttgcagggtttgtctaaggataaatatcctgtg |
11608639 |
T |
|
| Q |
219 |
atga |
222 |
Q |
| |
|
|||| |
|
|
| T |
11608640 |
atga |
11608643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University