View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8985_low_42 (Length: 328)
Name: NF8985_low_42
Description: NF8985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8985_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 51 - 321
Target Start/End: Original strand, 3527684 - 3527955
Alignment:
| Q |
51 |
tttctaactatttatttgagttctattttggtttaatatacatatagtttccattgcctcactggaaaggtttattttcattgcatttgactatattaat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3527684 |
tttctaactatttatttgagttctattttggtttaatatacatatagtttccattgcctcactggaaaggtttattttcattgcatttgactatattaat |
3527783 |
T |
 |
| Q |
151 |
caacgaggtgactctttatatccctagagtatagtcaatggtttctttctctctgattagtgatccatatctctcaaatcttcaatcttcattttctttt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3527784 |
caacgaggtgactctttatatccctagagtatagtcaatggtttctttctctctgattagtgatccatatctctcaaatcttcaatcttcattttctttt |
3527883 |
T |
 |
| Q |
251 |
gcgag-nnnnnnnnnnggagtcttttcgagttgcgttaggagcaggtaattagatagctgggatctctgctt |
321 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3527884 |
gcgagaaaaaaagaaaggagtcttttcgagttgcgttaggagcaggtaattagatagctgggatctttgctt |
3527955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University