View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8985_low_50 (Length: 290)
Name: NF8985_low_50
Description: NF8985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8985_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 115 - 270
Target Start/End: Original strand, 447438 - 447593
Alignment:
| Q |
115 |
aaatatgtctttgaaatgagtttgaaatttccaagctgcaatatcgatattctataaatgctctagagcatcaccaaggcaaaagatatgattctatttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
447438 |
aaatatgtctttgaaatgagtttgaaatttcctagctgcaatatcgatattctataaatgctctagagcatcaccaaggcaaaagatatgattctatttt |
447537 |
T |
 |
| Q |
215 |
atttacatattctaataatatagttcacattcattctcattttttatggctattct |
270 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
447538 |
atttacatattctaataatataattcacattcattctcattttttatggctattct |
447593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 4 - 119
Target Start/End: Original strand, 447291 - 447406
Alignment:
| Q |
4 |
aaaaggatcatgttatattgttgtttactggtgattgatctcaggaaagtcaaccaaatccaaaacacaaataaatgttcaattagtgcaactgtgggag |
103 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
447291 |
aaaaggatcatgttatattgctgtttactcgtgattggtctcaggaaagtcaaccaaattcaaaacacaaataaatgttcaattagtgcaactgtgggag |
447390 |
T |
 |
| Q |
104 |
tttgaacaagtaaata |
119 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
447391 |
tttgaacaagttaata |
447406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University