View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8985_low_55 (Length: 265)
Name: NF8985_low_55
Description: NF8985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8985_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 493454 - 493292
Alignment:
| Q |
1 |
atcaacaaaatttatcttcaaagcaaggcttaaatctctcc---------ctacaacaactcttgcaaaattattcaggtcctttataagatccaataaa |
91 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||| ||||||| || | ||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
493454 |
atcaacaaaaattatcttcaaagcaaggcctaaatctctccacaaactccctacaaccacacctgcaaaattatgcagatactttataagatccaataaa |
493355 |
T |
|
| Q |
92 |
gcctccagcacaaaaccaaggctataattctcattgtttttaactcatctaaagcaagaataa |
154 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
493354 |
gccttcagcacaaaaccaaggctataattctcattgtttttaactcgtctaatgcaagaataa |
493292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 165 - 228
Target Start/End: Complemental strand, 493223 - 493160
Alignment:
| Q |
165 |
tagattttggttgatgcaatgtgttttcatcagcatgtgtgaaacagaacttgccacagtgttg |
228 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
493223 |
tagattttggttgatgtaatgtgttttcatcagcatgtgtgaaacagaacttgccacggtgttg |
493160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University