View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8986_high_28 (Length: 346)

Name: NF8986_high_28
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8986_high_28
NF8986_high_28
[»] chr5 (1 HSPs)
chr5 (98-248)||(4287222-4287373)


Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 98 - 248
Target Start/End: Complemental strand, 4287373 - 4287222
Alignment:
98 atatcttgcgtcataacacagaacctttaaaaaggatcaccttttagcaactgcaagatagattgaaagtgtataaaatgatagattaaactgattac-a 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
4287373 atatcttgcgtcataacacagaacctttaaaaaggatcaccttttagcaactgcaagatagattgaaagtgtataaaatgatagattaaactgattacaa 4287274  T
197 aattgcaattcatattaagggatgattcgaaattagtttctaagacagtaaa 248  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||    
4287273 aattgcaattcatattaagggatgattcgaaattagtttcgaagacagtaaa 4287222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University