View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_high_28 (Length: 346)
Name: NF8986_high_28
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 98 - 248
Target Start/End: Complemental strand, 4287373 - 4287222
Alignment:
| Q |
98 |
atatcttgcgtcataacacagaacctttaaaaaggatcaccttttagcaactgcaagatagattgaaagtgtataaaatgatagattaaactgattac-a |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4287373 |
atatcttgcgtcataacacagaacctttaaaaaggatcaccttttagcaactgcaagatagattgaaagtgtataaaatgatagattaaactgattacaa |
4287274 |
T |
 |
| Q |
197 |
aattgcaattcatattaagggatgattcgaaattagtttctaagacagtaaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4287273 |
aattgcaattcatattaagggatgattcgaaattagtttcgaagacagtaaa |
4287222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University