View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8986_high_31 (Length: 331)

Name: NF8986_high_31
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8986_high_31
NF8986_high_31
[»] chr4 (1 HSPs)
chr4 (1-161)||(21012799-21012960)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 21012960 - 21012799
Alignment:
1 ttgtaaattgtttt-atagccagggaagaaaaatcagatgtgacactcatgtcatgtcatgttaatataattgaaccgttgggaattctgcaataataaa 99  Q
    |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||    
21012960 ttgtaaattgtttttatagccagggaagaaaaatcaaatgtgacactcatgtcatgtcatgttaatataattgaaccgtttggaattgtgcaataataaa 21012861  T
100 aacaaaataattgtttggatttactgcaaaatgcagcccatgcgtgagaaaaaagaaagagc 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21012860 aacaaaataattgtttggatttactgcaaaatgcagcccatgcgtgagaaaaaagaaagagc 21012799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University