View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_high_31 (Length: 331)
Name: NF8986_high_31
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 21012960 - 21012799
Alignment:
| Q |
1 |
ttgtaaattgtttt-atagccagggaagaaaaatcagatgtgacactcatgtcatgtcatgttaatataattgaaccgttgggaattctgcaataataaa |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
21012960 |
ttgtaaattgtttttatagccagggaagaaaaatcaaatgtgacactcatgtcatgtcatgttaatataattgaaccgtttggaattgtgcaataataaa |
21012861 |
T |
 |
| Q |
100 |
aacaaaataattgtttggatttactgcaaaatgcagcccatgcgtgagaaaaaagaaagagc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21012860 |
aacaaaataattgtttggatttactgcaaaatgcagcccatgcgtgagaaaaaagaaagagc |
21012799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University