View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_high_39 (Length: 291)
Name: NF8986_high_39
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_high_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 18100016 - 18099742
Alignment:
| Q |
1 |
gaaatgggtttggtgtgattttgtgttttgctttgagtggaaagggtggaggaggcatgcgtggaatgagaggtggacattttgggcatatttgcatgaa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18100016 |
gaaatgggtttggtgtgattttgcgttttgctttgagtggaaagggcggtggaggcatgcgtggaatgagaggtggacattttgggcatatttgcatgaa |
18099917 |
T |
 |
| Q |
101 |
tctgatgtggcagcttctccattggaaattgacagataaggttatctcattgttcaaatgttcaatcagaatctattaaatggaaagtgacaattcacta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18099916 |
tctgatgtggcagcttctccattggaaattgacagataaggttatctcattgttcaaatgttcaatcagcatctattaaattgaaagtgacaattcacta |
18099817 |
T |
 |
| Q |
201 |
aggagcataattgaagttctacgaaataacagattctgattttgaatgggtttgttcaaattcggtatttgggtt |
275 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18099816 |
aggagcataattgaagttgtacgaaataacagattctgattttgaatgggtttgttcaaattcggtatttgggtt |
18099742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University