View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_high_56 (Length: 216)
Name: NF8986_high_56
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_high_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 30654375 - 30654535
Alignment:
| Q |
1 |
ttgccgcaaccccagccaagtatgatcagacccaccatattaatatattcaatgatggagtagtcagtcttctccacacagatcaaaatccattgaatca |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
30654375 |
ttgccgccaccccagccaagtatgatcagacccaccatattaatatattcaacgatggagtagtcaatcgtctccacacatatcaaaatccattgaatca |
30654474 |
T |
 |
| Q |
101 |
attgttcgcaaatcccatttttaccatgacatccttcaagtatagccaataaatccgatca |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30654475 |
attgttcgcaaatcccatttttaccatgacatccttcaagtatagccaataaattcgatca |
30654535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 58 - 195
Target Start/End: Original strand, 14859275 - 14859413
Alignment:
| Q |
58 |
gagtagtcagtcttctccacacagatcaaaatccattgaatcaattgttc-gcaaatcccatttttaccatgacatccttcaagtatagccaataaatcc |
156 |
Q |
| |
|
||||||||| | ||| |||||| |||||||||||| |||||||||| || | |||||| ||||||||||||||||| || ||| || ||| | ||| | |
|
|
| T |
14859275 |
gagtagtcaaccgtcttcacacaaatcaaaatccatcgaatcaattgatcggtaaatccaatttttaccatgacatcttttaagcatggccggtcaattc |
14859374 |
T |
 |
| Q |
157 |
gatcacaagccttgctagtgtccagctttagtgcaacat |
195 |
Q |
| |
|
| || ||||||||||| |||| ||||| ||||||||| |
|
|
| T |
14859375 |
ggtcgtaagccttgctaatgtctagcttatgtgcaacat |
14859413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University