View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_high_58 (Length: 212)
Name: NF8986_high_58
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_high_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 19 - 133
Target Start/End: Complemental strand, 36415856 - 36415742
Alignment:
| Q |
19 |
tagaagtatgtccaatcacagtcacggtccacaagataagagtgttcaatcaatcatattttatttccaataacatgaaagtgttcaatcattgaaacta |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36415856 |
tagaagtatgttcaatcacagtcacggtccacaagataagagtgttcaatcaatcatattttatttccaataacatgaaagtgttcaatcattgaaacta |
36415757 |
T |
 |
| Q |
119 |
actctccaccaacac |
133 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36415756 |
actctccaccaacac |
36415742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 36415711 - 36415664
Alignment:
| Q |
164 |
gtactcctgaattttcacgaggtgttggttgtgttgtttgaatttcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36415711 |
gtactcctgaattttcacgaggtggtggttgtgttgtttgaatttcaa |
36415664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University