View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_107 (Length: 266)
Name: NF8986_low_107
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_107 |
 | |
|
| [»] scaffold0179 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 132 - 248
Target Start/End: Original strand, 895433 - 895549
Alignment:
| Q |
132 |
tcatagattgataagagatttaaagagagtctaccatgaccccgttttacagcggcaattttactttttagaaaaatgtgattgtgatatagcagttctc |
231 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
895433 |
tcatagattgataagagatttaaagagtgtctaccatgaccccgttttacagcggaaattttactttttagaaaaatgtgattgtgatatagcagttctc |
895532 |
T |
|
| Q |
232 |
gttttggtgtatgttga |
248 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
895533 |
gttttggtgtatgttga |
895549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 895302 - 895366
Alignment:
| Q |
1 |
ggtatcaatgagtggttgattccaacacggtttgataatcatgtaacacaaatttctcatcctgc |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
895302 |
ggtatcaatgagtggttgattccaacacggtttgataatcatgtaacacaaatttctcatcctgc |
895366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 132 - 248
Target Start/End: Complemental strand, 4964 - 4849
Alignment:
| Q |
132 |
tcatagattgataagagatttaaagagagtctaccatgaccccgttttacagcggcaattttactttttagaaaaatgtgattgtgatatagcagttctc |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4964 |
tcatagattgataagagatttaaagatagtctaccatgaccccgttttacagcggcagttttactttttagaaaaatgtgattgtgatatagcag-tctc |
4866 |
T |
|
| Q |
232 |
gttttggtgtatgttga |
248 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
4865 |
gttttggtttatgttga |
4849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 5096 - 5032
Alignment:
| Q |
1 |
ggtatcaatgagtggttgattccaacacggtttgataatcatgtaacacaaatttctcatcctgc |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5096 |
ggtatcagtgagtggttgattccaacacggtttgataatcatgtaacacaaatttctcatcctgc |
5032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University