View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_110 (Length: 260)
Name: NF8986_low_110
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_110 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 33508236 - 33508480
Alignment:
| Q |
1 |
acaatcttctaacaaagnnnnnnncctatattctgatcaatgtaaatatttt-ttgttagtttttgagaggatcaatgtagctattgtgttacgtgtgtc |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33508236 |
acaatcttctaacaaagaaaaaaacctatattctgatcaatgtaaatatttttttgttagtttttgagaggatcaatgtagctattgtgttacgtgtgtc |
33508335 |
T |
 |
| Q |
100 |
aatggtacgttgaatatatgggagaatttttataaaatgatgcgcgagatgatgtaattaggtcatcacatcatgcttttgctcgtctgaacgttacatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33508336 |
aatggtacgttgaatatatgggagaattttcataaaatgatgcgcgagatgatgtaattaggtcatcacatcatgcttttgctcgtctgaacgttacatc |
33508435 |
T |
 |
| Q |
200 |
aggtaagtctcatgctcttgattaggggtggaacaaacagcacag |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33508436 |
aggtaagtctcatgctcttgattaggggtggaacaaacagcacag |
33508480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University