View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_111 (Length: 257)
Name: NF8986_low_111
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_111 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 98 - 247
Target Start/End: Original strand, 37938715 - 37938864
Alignment:
| Q |
98 |
attgatagagatctcacttagcaggatcgtcaactttctctctcactacaagacaataatgcagccacaagtggtgaaggaccatcaagatcatttaatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37938715 |
attgatagagatctcacttagcaggatcgtcaactttctctctcactacaagacaataatgcagccacaagtggtgaaggaccatcaagatcatttcatg |
37938814 |
T |
 |
| Q |
198 |
agatctttagtcaaaaaattcaaagaacttcatctccattaccaccaaac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37938815 |
agatctttagtcaaaaaattcaaagaacttcatctccattaccaccaaac |
37938864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 37938611 - 37938643
Alignment:
| Q |
1 |
gtaaattcaatctgaatgttaattaattttctt |
33 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
37938611 |
gtaaattaaatctgaatgttaattaattttctt |
37938643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University