View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_120 (Length: 239)
Name: NF8986_low_120
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_120 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 53787035 - 53786809
Alignment:
| Q |
1 |
attggagtttagttatgtttcacttttatttattttaaaaatataaaagcactaccgaggttttatcgtgtccaggtcgtgtgtaaaagtttcgcactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53787035 |
attggagtttagttatgtttcacttttatttattttaaaa-tataaaagcactaccaaggttttatcgtgtccaggtcgtgtgtaaaagtttcgcactat |
53786937 |
T |
 |
| Q |
101 |
atagcaagcttcttnnnnnnnnntcatcctcaaaattcatattttgtctgattatgcaaaattaatttgtccaagttagttttcagacccaaaaataaca |
200 |
Q |
| |
|
||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53786936 |
ataacaagcttcttaaaaaaat-tcatcctcaaaattcatattttttctgattatgcaaaattaatttgtccaagttagtttccagacccaaaaataaca |
53786838 |
T |
 |
| Q |
201 |
caagagcaatgatctttataatgttgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53786837 |
caagagcaatgatctttataatgttgatg |
53786809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 43804627 - 43804732
Alignment:
| Q |
1 |
attggagtttagttatgtttcacttttatttattttaaaaatataaaagcactaccgaggttttatcgtgtccaggtcgtgtgtaaaagtttcgcactat |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43804627 |
attggattttagttatgtttcacttttatttattttaaaaatataaaagcactgccaaggttttatcgtgtccaggt--tgtgtaaaagtttcgcactat |
43804724 |
T |
 |
| Q |
101 |
atagcaag |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
43804725 |
atagcaag |
43804732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 35267133 - 35267211
Alignment:
| Q |
1 |
attggagtttagttatgtttcacttttatttattttaaaaatataaaagcactaccgaggttttatcgtgtccaggtcg |
79 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||| || | |||||| | ||||| ||||| |
|
|
| T |
35267133 |
attggattttagttatgttttacttttatttattttaaaaatataaaagcactgccaacgttttaccatgtccgggtcg |
35267211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University