View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_127 (Length: 234)
Name: NF8986_low_127
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_127 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 51930091 - 51930293
Alignment:
| Q |
19 |
gagccaatagtagttatcgatcctcacatcatggaaaagctccattttgtgctcaaccttcttcgccaccggaggaggaagcggagattgagactgcggc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51930091 |
gagccaatagtagttatcgatcctcacatcattgaaaagctccattttgtgctcaaccttcttcgccaccggaggaggaagcggagattgagaatgcggc |
51930190 |
T |
 |
| Q |
119 |
gaca------gagattgtggaggtgaagtcgtcatcggacggcggtggtgatgagagaacgcggcggtggtggaaaaaggaagagaaagagtgaggacgg |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51930191 |
gacagagattgagattgtggaggtgaagtcgtcatcggacggcggtggtgatgagagaacgcggcggtggtggaaaaaggaagagaaagagtgaggacgg |
51930290 |
T |
 |
| Q |
213 |
aaa |
215 |
Q |
| |
|
||| |
|
|
| T |
51930291 |
aaa |
51930293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University